International Journal of Molecular Sciences, Год журнала: 2025, Номер 26(2), С. 576 - 576
Опубликована: Янв. 11, 2025
High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, molecular mechanisms that MAPK12-induced GC repressed steroid hormone secretion remain unclear. In this study, GCs in P group (GCs with high PRL concentration: 500 ng/mL PRL) P-10 infected by lentiviruses carrying overexpressed sequences MAPK12) were collected for whole-transcriptome analysis. Then, we applied miRNA mimics combined a dual-luciferase reporter gene assay to explore through which affected hormones secretion. The analysis indicated regulated concentration mainly novel 58. expression pro-apoptotic proteins Caspase 3 Bax was increased, while anti-apoptotic protein BCL-2 declined 58-5p (p < 0.05); genes associated (CYP11A1, 3β-HSD CYP19A1) decreased 0.05), target gene, SREBF1 58, 0.05). Dual-luciferase showed confirmed as negative feedback interaction established between SREBF1. ggccggctgggggattgccg sequence may be site SREBF1, targeted 58-5p. addition, reduced suppressed after interference concentration. conclusion, targeting
Язык: Английский