Irrelationship between live coral cover and reef fish: an interim study of marine habitat dynamic on Mandangin Islands DOI Open Access
Budi Prabowo,

Aditya Bramandito,

Robba Fahrisy Darus

et al.

IOP Conference Series Earth and Environmental Science, Journal Year: 2023, Volume and Issue: 1260(1), P. 012014 - 012014

Published: Nov. 1, 2023

Abstract Most coral reef ecosystems with high coverage of living would escalate the fish abundance and species richness as one correlatable communities to reef. However, could only utilize provide community that still withstand adapt those conditions. This study aims assess ecosystem quality on Mandangin Islands correlation between benthic substrate structure. Coral was assessed using Line Intercept Transect Underwater Visual Census. A linear model or regression analysis built identify key predictors driving factor in ecosystem. Rock, Sand, Rubble are highest around Islands. Reef have a along observation site exhaustive trophic level, major functional group, broad bodied size small moderate bodied-size. Rock has positive abundance; Sand possibilities richness, whereas live negatively correlates fish. Historically contained healthy degraded after years, yet Islands’ ecosystems. is loses several its function, especially direct nourishment. showed should be considered primary data strengthen decision-making Integrated Coastal Management Oil Spill Contingency Plans by Gas Company.

Language: Английский

Detection of sea urchins (Diadema setosum) colony distribution on UAV imagery data using fuzzy logic spproach DOI Creative Commons
Ayub Sugara, Yenni Putri Sari,

M S Sangadji

et al.

Kuwait Journal of Science, Journal Year: 2025, Volume and Issue: unknown, P. 100389 - 100389

Published: Feb. 1, 2025

Language: Английский

Citations

0
Molecular phylogeny of grouper of Epinephelus genus in Jayapura, Papua, Indonesia inferred from Cytochrome Oxidase I (COI) gene DOI Open Access

SUKMA DWIFAJRI,

Ricardo F. Tapilatu, Bayu Pranata

et al.

Biodiversitas Journal of Biological Diversity, Journal Year: 2022, Volume and Issue: 23(3)

Published: March 2, 2022

Abstract. Dwifajri S, Tapilatu RF, Pranata B, Kusuma AB. 2022. Molecular phylogeny of grouper Epinephelusgenus in Jayapura, Papua, Indonesiainferred from Cytochrome Oxidase I (COI) gene. Biodiversitas 23: 1449-1456. Grouper (Serranidae: Epinephelinae: Epinephelus) fish have high economic value, and are relatively overfis hed, yet not received serious attention to determine conservation status by the International Union for Conservation Nature (IUCN). DNA barcoding is an important molecular approach identify Papua's species. The objective present study was analyze species diversity Epinephelus based on sequences mitochondrial control region COI Samples were collected Hamadi, Sentani, Youtefa local markets Papua during August 2020. morphologically identified, photographed its fin clipped preserved analysis. Present used primers, i.e., Fish R1 5'TAGACTTCTGGCCAAGAATCA3' F1 5'TCAACCAACCACAAAGACATTGGCA3'. Based gene bank comparison at sequence length 689 base pairs, obtained seven Epinephelinae), namely areolatus, coioides, episictus, kupangensis, macrospilos, melanostigma merra. phylogenetic tree composed clades, where each represented clade. genetic distance between kupangensis determined as closest (0.123) study, while farthest one found episictus merra (0.161).

Language: Английский

Citations

11
Abundance and diversity of reef fish species and their relationship with corals along the eastern coast of Sri Lanka DOI
E. P. D. N. Thilakarathne,

N. W. Ramawickrama,

Tharindu Bandara

et al.

Journal of Coastal Conservation, Journal Year: 2024, Volume and Issue: 28(1)

Published: Feb. 1, 2024

Language: Английский

Citations

2
Coral diversity matches marine park zonation but not economic value of coral reef sites at St. Eustatius, eastern Caribbean DOI Creative Commons
Bert W. Hoeksema, Luna M. van der Loos, G.W.N.M. van Moorsel

et al.

Journal of Environmental Management, Journal Year: 2022, Volume and Issue: 320, P. 115829 - 115829

Published: Aug. 15, 2022

Stony corals play a key role in the marine biodiversity of many tropical coastal areas as suppliers substrate, food and shelter for other reef organisms. Therefore, it is remarkable that coral diversity usually does not planning protected areas. In present study we examine how stony patterns relate to park zonation economic value reefs around St. Eustatius, small island eastern Caribbean, with fisheries tourism important sources income. The contains two no-take reserves. A survey was performed at 39 sites, 24 inside reserves 15 outside; 22 had maximum depth >18 m 17 were shallower. Data on per site obtained from literature. Corals photographed verification identifications made field. Coral species richness (n = 49) highest composition mainly affected by depth. No distinct relation observed between fishery or total value. Based outcome this suggest future designs areas, should be taken into consideration. This best served including continuous gradient shallow flats deep slopes.

Language: Английский

Citations

7
Potential of Coral Resilience Post Bleaching in 2016 in the Water of Ujong Seuke East Coast of Weh Island Indonesia DOI Open Access
Nadia Aldyza, Ternala Alexander Barus, Miswar Budi Mulya

et al.

KnE Life Sciences, Journal Year: 2024, Volume and Issue: unknown

Published: March 27, 2024

Mass bleaching occurred in 2010 Southeast Asia waters such as Thailand, Malaysia, and Indonesia. One of the Indonesian that experienced was Weh Island area, which then underwent again 2016 had impacts on coral ecosystem. Substrate changes cover conditions are noteworthy to determine potential for recovery after bleaching. Therefore, study aims measure condition resilience 2016. Benthic data collection used Point Intercept Transect method while measuring index through indicators, fleshy seaweed, rubble. The observation showed Ujong Seuke 34%, seaweed by 2.83%, rubble 21.17%. This research concludes reef ecosystems phenomenon moderate condition, it has a high resilience. Keywords: coral, bleaching, water, ujong seuke, east coast,

Language: Английский

Citations

1
Health status of coral reef at Moramo Bay Marine Conservation Area, Southeast Sulawesi, Indonesia DOI Open Access

Dedy Oetama,

Luchman Hakim, Tri Djoko Lelono

et al.

Biodiversitas Journal of Biological Diversity, Journal Year: 2024, Volume and Issue: 25(4)

Published: April 17, 2024

Abstract. Oetama D, Hakim L, Lelono TD, Musa M. 2024. Health status of coral reef at Moramo Bay Marine Conservation Area, Southeast Sulawesi, Indonesia. Biodiversitas 25: 1454-1464. is one the regional Areas (MCA) in Indonesia which categorized as a Tourism Park based on Decree Minister Maritime Affairs and Fisheries Republic Number 22 2021. This bay located Sulawesi Province has an area 21,902.34 ha, consisting core zone, limited-use other zones. The ecosystems found include reefs, mangroves, seagrass. ecosystem this covers 2,528.19 ha with good visual conditions reef. present study aims to provide detailed information concerning condition live hard corals fishes, including abundance, diversity, evenness, dominance, water quality by using point intercept transect (PIT) underwater census (UVC) methods. was carried out 7-10 meters seawater depth May-October 2023, focusing both zones three stages: field observation, data collection, analysis. Data collection covered identifying growth through literature before performing descriptive revealed percentage cover 53%, referred category, variable percentages dead (4%), algae (9%), soft fleshy seaweed (1%), rubble (17%), sand (8%), silt (1% ) sponge (2%). Furthermore, 25 families fishes were found, belonging 48 genera, 102 species, 2,364 individuals, ecological index abundance 1.05 ind.m-2, diversity (2.86), evenness (0.83), dominance (0.10). health issued implies that MCA may be preserved alternative for studies associated global issues, instance, climate changes. Protecting increasing sustainability reefs absolute entity must considered local government.

Language: Английский

Citations

1
Distribution Pattern of Coral Reef Fishes in China DOI Open Access
Juan Shi,

Chunhou Li,

Teng Wang

et al.

Sustainability, Journal Year: 2022, Volume and Issue: 14(22), P. 15107 - 15107

Published: Nov. 15, 2022

Coral reefs are known as “tropical rain forests” in the ocean. Fish diversity is extremely high, accounting for one-third of marine fishes. To better protect and manage coral reef fishes, this study systematically compiled documents databases published China. We counted 2855 species fishes China, which belong to 3 classes, 41 orders, 252 families, 1017 genera. Among these, Perciformes was dominant order, 57.31% total species. Gobiidae (7.43%), Labridae (5.36%), Pomacentridae (4.52%), Serranidae (4.38%) were main while other families accounted less than 4%. Furthermore, 5.56% fish have entered IUCN Red List. The present found that can be divided into nearshore offshore. This mainly because more affected by human disturbance runoff from mainland, whereas offshore areas with high salinity temperature far where less. species’ had a significant positive correlation (p < 0.05), corals provide habitat shelter. first systematic compilation analysis China provides basic reference global protection management biological geographical analysis.

Language: Английский

Citations

6
A contemporary baseline of Madagascar’s coral assemblages: Reefs with high coral diversity, abundance, and function associated with marine protected areas DOI Creative Commons
Mahery Randrianarivo, François Guilhaumon,

Johanès Tsilavonarivo

et al.

PLoS ONE, Journal Year: 2022, Volume and Issue: 17(10), P. e0275017 - e0275017

Published: Oct. 20, 2022

Madagascar is a major hotspot of biodiversity in the Western Indian Ocean, but, as many other regions, coral reefs surrounding island confront large-scale disturbances and human-induced local stressors. Conservation actions have been implemented with encouraging results for fisheries, though their benefit on assemblages has never rigorously addressed. In this context, we analyzed multiscale spatial variation composition, generic richness, abundance, life history strategies, cover among 18 stations placed at three regions around island. The potential influences marine protected areas (MPAs), algal cover, substrate rugosity, herbivorous fish biomass, geographic location were also analyzed. Our highlight marked variability, either or both regional scales all descriptors. northeast coastal region Masoala was characterized by high abundance colonies, most notably competitive Acropora Pocillopora genera stress-tolerant taxa several stations. southwest station Salary Nord distinguished lower abundances, depauperate populations taxa. On northwest coast, Nosy-Be higher diversity well (~42-70%) recorded unfished Results clearly underline positive effects MPAs but one descriptors, particularly where highest contrast between fished observed. Biomass fishes, crustose coralline algae rugosity positively related to occurrence diversity, corals, including Acropora, finding study. strongly support implementation locally managed strong involvement primary users, assist management countries reduced logistic human resources such Madagascar.

Language: Английский

Citations

5
Interactions between hard corals and reef fish communities in the Komodo National Park, East Nusa Tenggara Timur DOI Open Access
Tri Aryono Hadi,

P A W Sujono,

C Clarita

et al.

IOP Conference Series Earth and Environmental Science, Journal Year: 2023, Volume and Issue: 1137(1), P. 012004 - 012004

Published: Jan. 1, 2023

Abstract The Komodo National Park is one of the largest Parks in Indonesia that conserves not only terrestrial to protect habitat dragons but also marine areas. ecosystems play important roles protecting shoreline from abrasion and supporting sustainability seafood supplies for local communities. This study presents observed interactions between hard corals (number species coverage) reef fish communities species, abundance, biomass). Coral monitoring was conducted at 12 stations 2019. found 211 with an average coral cover 30.84%. There no significant correlation number However, branching shows a herbivorous (the biomass. Such may be attributed structural complexity which provides shelters prevent predation. Although are physically vulnerable destruction bleaching, their existence can promote population resilience.

Language: Английский

Citations

2
Sea urchins of Peninsular Malaysia: Spatial distribution and species-habitat association DOI
Man Ying Mok, Yang Amri Affendi, Jillian Lean Sim Ooi

et al.

Regional Studies in Marine Science, Journal Year: 2023, Volume and Issue: 61, P. 102919 - 102919

Published: March 5, 2023

Language: Английский

Citations

2