Semi-automated workflow for high-throughput Agrobacterium-mediated plant transformation DOI Creative Commons
Davide Annese, Facundo Romani, Carolina Grandellis

et al.

bioRxiv (Cold Spring Harbor Laboratory), Journal Year: 2024, Volume and Issue: unknown

Published: Oct. 10, 2024

ABSTRACT High-throughput experiments in plants are hindered by long generation times and high costs. To address these challenges, we present an optimized pipeline for Agrobacterium tumefaciens transformation simplified a protocol to obtain stable transgenic lines of the model liverwort Marchantia polymorpha , paving way efficient high-throughput plant synthetic biology other applications. Our involves freeze-thaw method 6-well plates that can be adapted robotic automation. Using Opentrons open-source platform, implemented semi-automated showing similar efficiency compared manual manipulation. Additionally, have streamlined process selection M. reducing cost, time, labour without compromising efficiency. The addition sucrose media significantly enhances production gemmae, accelerating isogenic plants. We believe protocols potential facilitate screenings diverse species represent significant step towards full automation pipelines. This approach allows testing ∼100 constructs per month, using conventional tissue culture facilities. recently demonstrated successful implementation this screening hundreds fluorescent reporters gemmae.

Language: Английский

A pilot oral history of plant synthetic biology DOI Creative Commons
Jaya Joshi, Andrew D. Hanson

PLANT PHYSIOLOGY, Journal Year: 2024, Volume and Issue: 195(1), P. 36 - 47

Published: Jan. 2, 2024

Abstract The whole field of synthetic biology (SynBio) is only about 20 years old, and plant SynBio younger still. Nevertheless, within that short time, in general has drawn more scientific, philosophical, government, private-sector interest than anything since the recombinant DNA revolution. Plant SynBio, particular, now drawing relation to plants’ potential help solve planetary problems such as carbon capture storage replacing fossil fuels feedstocks. As so young fast-developing, we felt it was too soon try analyze its history. Instead, set out essence SynBio's origins early development through interviews with 8 field's founders, representing 5 countries 3 continents. We then distilled these founders’ personal recollections reflections into this review, centering narrative on timelines for pivotal events, articles, funding programs, quoting from interviews. have archived interview recordings documented timeline entries. This work provides a resource future historical scholarship.

Language: Английский

Citations

10
Recent advances of CRISPR-based genome editing for enhancing staple crops DOI Creative Commons
Feng Chen, Chen D. Lu, Yan Zhao

et al.

Frontiers in Plant Science, Journal Year: 2024, Volume and Issue: 15

Published: Sept. 23, 2024

An increasing population, climate change, and diminishing natural resources present severe threats to global food security, with traditional breeding genetic engineering methods often falling short in addressing these rapidly evolving challenges. CRISPR/Cas systems have emerged as revolutionary tools for precise modifications crops, offering significant advancements resilience, yield, nutritional value, particularly staple crops like rice maize. This review highlights the transformative potential of technology, emphasizing recent innovations such prime base editing, development novel CRISPR-associated proteins, which significantly improved specificity, efficiency, scope genome editing agriculture. These enable targeted that enhance tolerance abiotic stresses well biotic stresses. Additionally, plays a crucial role improving crop yield quality by enhancing photosynthetic nutrient uptake, resistance lodging, while also taste, texture, shelf life, content through biofortification. Despite challenges off-target effects, need more efficient delivery methods, ethical regulatory concerns, underscores importance security sustainability It calls continued research integration CRISPR other emerging technologies nanotechnology, synthetic biology, machine learning fully realize its developing resilient, productive, sustainable agricultural systems.

Language: Английский

Citations

10
Novel synthetic inducible promoters controlling gene expression during water‐deficit stress with green tissue specificity in transgenic poplar DOI Creative Commons
Yongil Yang, Timothy A. Chaffin,

Yuanhua Shao

et al.

Plant Biotechnology Journal, Journal Year: 2024, Volume and Issue: 22(6), P. 1596 - 1609

Published: Jan. 17, 2024

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the of leaf palisade vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis laser capture microdissection. Hexamerized four 20-base were inserted into each synthetic construct. Two these (Syn2 Syn3) induced GFP transformed mesophyll protoplasts incubated 0.5 M mannitol solution. To identify effect length sequence a valuable 20 base motif, 5' 3' regions basic (GTTAACTTCAGGGCCTGTGG) Syn3 hexamerized to generate two shorter promoters, Syn3-10b-1 (5': GTTAACTTCA) Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities compared with plants. specifically transient agroinfiltrated Nicotiana benthamiana leaves water cessation 3 days. In stable transgenic poplar, presented as constitutive but had highest activity leaves. stronger induction green tissues under stress conditions than mock control. Therefore, containing endowed both tissue-specificity inducibility whereas did not. Consequently, we have added new engineering toolkit: Syn3-10b-1, tissue-specific stress-induced promoter, Syn3, tissue-preferential promoter.

Language: Английский

Citations

5
Genetically encoded Boolean logic operators to sense and integrate phenylpropanoid metabolite levels in plants DOI Creative Commons
Sávio Siqueira Ferreira, Mauricio S. Antunes

New Phytologist, Journal Year: 2024, Volume and Issue: 243(2), P. 674 - 687

Published: May 16, 2024

Synthetic biology has the potential to revolutionize biotechnology, public health, and agriculture. Recent studies have shown enormous of plants as chassis for synthetic applications. However, tools precisely manipulate metabolic pathways bioproduction in are still needed. We used bacterial allosteric transcription factors (aTFs) that control gene expression a ligand-specific manner tested their ability repress semi-synthetic promoters plants. also modulation repression activity response specific plant metabolites, especially phenylpropanoid-related molecules. Using these aTFs, we designed genetic circuits capable computing Boolean logic operations. Three CouR, FapR, TtgR, achieved c. 95% respective target promoters. For sixfold de-repression could be triggered by inducing its ligand accumulation, showing use biosensor. Moreover, AND, NAND, IMPLY, NIMPLY operations integrate metabolite levels input circuit. showed biosensors can implemented detect metabolites activate circuit follows predefined logic, demonstrating exerting over facilitating natural products.

Language: Английский

Citations

5
Utilizing Plant Synthetic Biology to Accelerate Plant-Microbe Interactions Research DOI Creative Commons
Xiaohan Yang, Joanna Tannous, Tomás A. Rush

et al.

BioDesign Research, Journal Year: 2025, Volume and Issue: unknown, P. 100007 - 100007

Published: March 1, 2025

Language: Английский

Citations

0
Research Progress in Sesuvium portulacastrum (L.) L. in the Present-Day Era: Challenges and Projections DOI
Vishwas A. Bapat, Ganesh C. Nikalje, Penna Suprasanna

et al.

Published: Jan. 1, 2025

Language: Английский

Citations

0
Demethylating drugs alter protoplast development, regeneration, and the genome stability of protoplast-derived regenerants of cabbage. DOI
Agnieszka Kiełkowska, Agnieszka Brąszewska-Zalewska

PubMed, Journal Year: 2025, Volume and Issue: 25(1), P. 463 - 463

Published: April 11, 2025

Language: Английский

Citations

0
Semi‐automated workflow for high‐throughput Agrobacterium‐mediated plant transformation DOI Creative Commons
Davide Annese, Facundo Romani, Carolina Grandellis

et al.

The Plant Journal, Journal Year: 2025, Volume and Issue: 122(1)

Published: April 1, 2025

High-throughput experiments in plants are hindered by long generation times and high costs. To address these challenges, we present an optimized pipeline for Agrobacterium tumefaciens transformation a simplified protocol to obtain stable transgenic lines of the model liverwort Marchantia polymorpha, paving way efficient high-throughput plant synthetic biology other applications. Our involves freeze-thaw method six-well plates that can be adapted robotic automation. Using Opentrons open-source platform, implemented semi-automated showing similar efficiency compared manual manipulation. Additionally, have streamlined process selection M. reducing cost, time, labor without compromising efficiency. The addition sucrose media significantly enhances production gemmae, accelerating isogenic plants. We believe protocols potential facilitate screenings diverse species represent significant step towards full automation pipelines. This approach allows testing ~100 constructs per month, using conventional tissue culture facilities. recently demonstrated successful implementation this screening hundreds fluorescent reporters gemmae.

Language: Английский

Citations

0
Harnessing transposable elements for plant functional genomics and genome engineering DOI Creative Commons
Xiaoyuan Tao, Siyu Feng, Yuan Lü

et al.

Trends in Plant Science, Journal Year: 2025, Volume and Issue: unknown

Published: April 1, 2025

Transposable elements (TEs) constitute a large portion of many plant genomes and play important roles in regulating gene expression driving genome evolution crop domestication. Despite advances understanding the functions mechanisms TEs, comprehensive review their integrated knowledge cutting-edge biotechnological applications TEs is still needed. We provide thorough overview that connects discoveries, mechanisms, technologies associated with TEs. discuss identification function driven by functional genomics, epigenetic regulation utilization active genomics engineering. In summary, expanding application will be beneficial to breeding synthetic biology future.

Language: Английский

Citations

0
A tRNA-gRNA multiplexing system for CRISPR genome editing inMarchantia polymorpha DOI Creative Commons
Eftychios Frangedakis, Nataliya E. Yelina,

Satish Kumar Eeda

et al.

bioRxiv (Cold Spring Harbor Laboratory), Journal Year: 2025, Volume and Issue: unknown

Published: April 20, 2025

Abstract The liverwort Marchantia polymorpha is a widely used model organism for studying land plant biology, which has also proven to be promising testbed bioengineering. CRISPR/Cas9 technology emerged as transformative tool precise genome modifications in M. . However, robust method the simultaneous expression of multiple gRNAs, crucial enhancing efficiency and versatility CRISPR/Cas9-based editing, yet fully developed. In this study, we introduce an adaptation from OpenPlant kit tools, that facilitates gRNAs single transcript through incorporation tRNA sequences. This approach significantly improves scalability editing Additionally, by combining vector system with simplified optimized protocol thallus transformation, further streamline generation mutants resulting gene- offers versatile, time-saving straightforward advancing functional genomics , enabling more comprehensive genetic engineering.

Language: Английский

Citations

0